Mass Production of Arbuscular Mycorrhizal Fungi on the Sorghum Plants Inoculated with Burkholderia arboris Using Soybean Mill Waste and Vermicompost-Amended Soil-Sand Substrate.

Arbuscular mycorrhizal (AM) fungi are being used as a new generation of biofertilizers to increase plant growth by improving plant nutrition and bio-protection. However, because of the obligatory nature of the plant host, large-scale multiplication of AM propagules is challenging, which limits its applicability. This study evaluates the ability of Burkholderia arboris to increase AM production in soybean mill waste and vermicompost amended by soil-sand mixture planted with sorghum as a host plant. The experiment was conducted in a nursery using a completely randomized design with four inoculation treatments (B. arboris, AM fungi, B. arboris + AM fungi, and control) under sterilized and unsterilized conditions. AM production was investigated microscopically (spore density and root colonization), and biochemically (AM-specific lipid biomarker, 16:1ω5cis derived from neutral lipid fatty acid (NLFA), and phospholipid fatty acid (PLFA) fractions from both soil and roots). Integrating B. arboris with AM fungi in organically amended pots was found to increase AM fungal production by 62.16 spores g-1 soil and root colonization by 80.85%. Biochemical parameters also increased with B. arboris inoculation: 5.49 nmol PLFA g-1 soil and 692.68 nmol PLFA g-1 root and 36.72 nmol NLFA g-1 soil and 3147.57 nmol NLFA g-1 root. Co-inoculation also increased glomalin-related soil protein and root biomass. Principal component analysis (PCA) further supported the higher contribution of B. arboris to AM fungi production under unsterilized conditions. In conclusion, inoculation of AM plant host seeds with B. arboris prior to sowing into organic potting mix could be a promising and cost-effective approach for increasing AM inoculum density for commercial production. Furthermore, efforts need to be made for up-scaling the AM production with different plant hosts and soil-substrate types.

First report of milkweed (Euphorbia geniculata) as an alternative host for Colletotrichum truncatum in soybean fields in India.

Soybean (Glycine max, L.), a major oilseed crop of India faces anthracnose disease caused by Colletotrichum truncatum (Nataraj et al. 2021). Several weeds serve as alternative hosts for Colletotrichum spp. (Hartman et al. 1986). Around 24.67% of soybean fields in the study area were infested with Euphorbia geniculata (Kutariye et al. 2021). In September 2021, milkweed plants died in the field, showing irregular circular lesions with wavy margins on the stem, change in color of veins and veinlets from brown to black and leaves exhibiting a twisted appearance at ICAR-Indian Institute of Soybean Research, India. Later on plants completely died and acervuli of average size 284 µm were visualized under stereo microscopy. Twenty milkweed samples were collected, rinsed, and surface sterilized with NaOCl (1%). Fungus isolation was done from leaf and stem and transferred to sterilized Petri plates with Potato dextrose agar (PDA). The plates were incubated at 25 ± 2°C for 48 h with dark/light (10h/14h) cycle. The fungi produced circular, raised, black to light grey colonies. Sickle shaped aseptate conidia, measuring 23.14 µm length, 3.18 µm width and hyphal width 5.49 µm were confirmed using a compound microscope with 20X magnification. The fungus was purified via hyphal tip method and pure culture was maintained on PDA at (26 ± 2°C). Milkweed seedlings in clay pots were inoculated with a conidial suspension of the fungus (106 conidia/mL) prepared from ten days old culture using serial dilution technique. Soybean variety JS 95-60 was inoculated by atomizing 20 ml of the same suspension on each plant. The negative controls for both milkweed and soybean were inoculated with sterile distilled water. Veinal necrosis and acervuli formation were observed on both milkweed and soybean, but no signs or symptoms of disease were observed in the controls. The re-isolated fungus from both the diseased hosts resembled original culture as they produced black to light grey colonies, sickle shaped aseptate conidia and ITS sequence (OR124845) exhibiting 100% resemblance to C. truncatum isolate C-17 (MN736513), thus confirming Koch's postulates. The pathogen was classified as Colletotrichum spp. based on morphological and cultural characters and the pathogenicity test (Rajput et al. 2021). To confirm identity of the pathogen infecting milkweed, DNA was extracted from the reisolated fungus using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The internal transcribed spacer (ITS) region, beta-tubulin (TUB2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified (Kumar et al. 2021). The GAPDH gene was amplified under similar reaction conditions except for annealing temp 59°C. For species level identification, the ITS, TUB2 and GAPDH gene sequences were submitted to GenBank with accession numbers OR004468, OQ869780 and OQ869781, respectively. The BLAST analysis of TUB2 and GAPDH gene showed sequence homology of 100% and 98.43% respectively with C. truncatum culture-collection CBS:151.35 (GU228156, GU228254). The isolate was identified as C. truncatum on the basis of molecular analysis, corroborating the above morphological identification. This is the first report of C. truncatum infecting milkweed in India, indicating milkweed as an alternative host in soybean fields, potentially raising inoculum levels and carryover between crops.

First report of root rot and damping off disease in soybean (Glycine max) caused by Pythium deliense in India.

Seedling rot symptoms were observed at Research Farm of ICAR-Indian Institute of Soybean Research, Indore, India. The infected seedlings had water-soaked lesions on the cotyledons and hypocotyls that gradually developed into brown lesions and further progressed to soft rot. These seedlings could be easily pulled-off from the soil. The diseased seedling samples were rinsed thoroughly in flowing tap water and eventually in double-distilled water and were subjected to surface sterilization with NaOCl(1%). The samples were further washed thrice with sterilized double distilled water. The root fragments were properly sterilized and placed on V8 juice agar as well as potato dextrose agar (PDA) media plates. These plates were incubated at 27± 2°C for 48 hours. After incubation, white fluffy mycelial growth was observed on both the media. The fungus was observed to produce brown round vesicles with mycelial attachment when observed under a compound microscope magnification of 20X. Subcultures of these fungal isolates were placed on PDA media and incubated for 7 days at (27±2°C). The pure fungal culture along with PDA media was cut into small pieces and mixed with a sterilized soil mix (70% soil and 20% sand and 10 % vermicompost) at the rate of one petri dish per pot (plastic pots of 10 cm depth) and covered properly with tin foil. These pots were subjected to substrate colonization for 10 days at room temperature and the substrates were shaken occasionally to improve infection efficiency of pathogen by enhacing inocula production. Seeds of soybean variety, Gaurav were sown in three replicates, each with 10 seeds in the inoculated pots. The control was established by sowing seeds in the soil mix, amended previously with plain PDA. The pots were maintained at 25 to 30 ºC with 45 to 50 % of soil moisture content under glasshouse conditions. In the inoculated pots, the fungus killed soybean seeds before and after germination. Some of the plants that emerged developed lesions were initially yellow and gradually turned to necrotic later. These lesions were found on the roots of the plant and at the base of the hypocotyl region. The soybean seeds planted in un-inoculated soil emerged but did not develop any necrotic lesions. When the causal organism was re-isolated from the diseased plant part it was found to be morphologically and culturally similar to theoriginal culture. The isolated pathogen was thus classified as Pythium deliense based on morphological and cultural characters as well as the pathogenicity test. (Plaats-Niterink 1981). For further confirmation of pathogen's identity, complete genomic DNA of the fungus was extracted using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The nuclear rDNA region of the internal transcribed spacer and 5.8S rDNA was amplified by universal primers ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS 4 (5' TCCTCCGCTTATTGATATGC 3') as mentioned by White et al. (1990). Amplification was performed in a 12.5 µL reaction volume containing 1.5 µL of 10X PCR buffer, 3 µL of 25 mM MgCl2, 1.2 µL of 2.5 mM deoxyribonucleotide triphosphates (dNTPs), 0.7 µL of 10 pM each primer (ITS 1 and ITS 4), and 1 µL of DNA template, 0.3 µL of 1 units of Taq DNA polymerase. The thermal cycle consisted of 4-minute initial denaturation at 94°C, followed by 35 cycles of 1-minute denaturation at 95°C, 30-second primer annealing at 57 The PCR products were sequenced and submitted to NCBI (GenBank Acc. MT2665888). The BLAST study of the fungal isolate showed 100% similarity with reference sequences of Pythium deliense (MT126658.1) in the GenBank. The isolate was identified as Pythium deliense on the basis of molecular analysis, corroborating the above morphological identification. Further, the beta-tubulin gene (Bt) was amplified with primers BtF (5'GCTGGCCTTGATGTTGTTCG3') and BtR (5'CGTGA AGAGTACCCAGAC CG3'). Similarly, the cytochrome oxidase gene was amplified with primers COXF (5'GGTGCTTTTTCAGGTGTAGTTGG3') and COXR (5'GCTCCTGCTAATACTGGTAATG T3'). The PCR products were sequenced and submitted to GenBank with accession numbers MW196444 and MW196445 respectively. In BLAST analysis, the beta-tubulin gene exhibited 100 percent sequence homology with Pythium deliense (MK752986.1) and cytochrome oxidase gene also showed 100 % sequence homology with Pythium deliense (HQ708566.1). Pythium deliense has been recorded worldwide causing disease in many agricultural crops including soybean but to our knowledge, this is the first study in India of the genus Pythium and Pythium deliense causing root rot and damping off of soybean.